International Journal of Medical Sciences

Impact factor
2.284

17 August 2018

ISSN 1449-1907 News feeds of published articles

Manuscript login | Account

open access Global reach, higher impact

Theranostics

Journal of Cancer

International Journal of Biological Sciences

Journal of Genomics

Journal of Bone and Joint Infection (JBJI)

Oncomedicine

Journal of Biomedicine

Nanotheranostics

PubMed Central Indexed in Journal Impact Factor

Int J Med Sci 2018; 15(12):1355. doi:10.7150/ijms.29056

Erratum

Association of Genes Variants in RANKL/RANK/OPG Signaling Pathway with the Development of Osteonecrosis of the Femoral Head in Chinese Population: Erratum

Yang Song1,3, Zhen-wu Du1,2,3, Qi-wei Yang2,3, Ming Ren1,2, Qing-yu Wang2,3, Ao Wang1,3, Gao-yang Chen2,3, Hai-yue Zhao2,3, Tao Yu1,2 Corresponding address, Gui-zhen Zhang1,2,3 Corresponding address

1. Department of Orthopedics of Second Clinical College, Jilin University, Changchun, 130041, China;
2. Research Center of Second Clinical College, Jilin University, Changchun, 130041, China;
3. The Engineering Research Center of Molecular Diagnosis and Cell Treatment for Metabolic Bone Diseases of Jilin Province, Changchun, 130041, China.

This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions.
How to cite this article:
Song Y, Du Zw, Yang Qw, Ren M, Wang Qy, Wang A, Chen Gy, Zhao Hy, Yu T, Zhang Gz. Association of Genes Variants in RANKL/RANK/OPG Signaling Pathway with the Development of Osteonecrosis of the Femoral Head in Chinese Population: Erratum. Int J Med Sci 2018; 15(12):1355. doi:10.7150/ijms.29056. Available from http://www.medsci.org/v15p1355.htm

Corrected-article in Int J Med Sci, Volume 14, 690

 

In our paper [1], Table 2 should be corrected as follows.

 Table 2 

List of PCR and sequencing primers of 10 SNPs

SNP-IDPCR primerProduct length(bp)Sequencing primerMolecular weight
OPG rs20736175'ACGTTGGATGTTTCCGCCCCAGCCCTGAAA3'100AAAGCCCTGAAAGCGTTAA5829.8
5'ACGTTGGATGTTTTTAGGAAGCTTGGGCGG3'
OPG rs20736185'ACGTTGGATGGACTTACCACGAGCGCGCA3'87GGGGAGAGCGCGCAGCACAGCAA7157.7
5'ACGTTGGATGTCCAAGCCCCTGAGGTTTC3'
TRAF6
rs5030411
5'ACGTTGGATGAACGCTTTGACCTAGGAATG3'110GGGAACTAGGAATGATATGCATCCTTCT8627.6
5'ACGTTGGATGTTCCCTTTGCAATCAGGCAG3'
TRAF6
rs5030416
5'ACGTTGGATGTCTGCATATTTGGTTCATCG3'104TGGTTCATCGTCCACC4808.1
5'ACGTTGGATGGCATTCTGGCTTCAGGATAC3'
RNAK rs8842055'ACGTTGGATGTCTTTCACTGGGTACCCAGG3'127TGGTACCCAGGCTGTATTTTAA6740.4
5'ACGTTGGATGATTCCCTGGACCACAGACTA3'
RANKL rs79848705'ACGTTGGATGAACAACTAAACCCACAATG3'130ATTTTACTATAGTGTCTTCCATT6969.6
5'ACGTTGGATGTGAGGATCAAGATGTCAAGG 3'
RANKL rs95256415'ACGTTGGATGCTGAGGTGCAATCCTTATCC 3'94GGTGTCCTCTGCGTCTTC5448.5
5'ACGTTGGATGTTCTGGAGGTCCAAGAGATG 3'
RANKL rs10540165'ACGTTGGATGCTTTTTTGCTGATAAACCAC3'102CACTAATAACTTTTCTATTTTGAAAAAA8528.6
5'ACGTTGGATGTGTTTTTCCACAAGTGCCGC3'
NFATC1
rs754093
5'ACGTTGGATGAAGACCATACTACAGCCAGC 3'120TCAGCGTGCCCAGCAAGGCCTACAC7596.9
5'ACGTTGGATGTGGCATCAGGGTGCTTCTCT 3'
NFATC1
rs9518
5'ACGTTGGATGTGTACAGAGTGCCCAGCAAG3'94CCCCGCCGGCTTCCCGCCC5622.6
5'ACGTTGGATGCCTGCGTTGTGTGTTTTCAG3'

References

1. Song Y, Du Zw, Yang Qw, Ren M, Wang Qy, Wang A, Chen Gy, Zhao Hy, Yu T, Zhang Gz. Association of Genes Variants in RANKL/RANK/OPG Signaling Pathway with the Development of Osteonecrosis of the Femoral Head in Chinese Population. Int J Med Sci. 2017;14(7):690-697 doi:10.7150/ijms.19124

Author contact

Corresponding address Corresponding authors: Tao Yu M.D. and Ph.D. Department of Orthopedics of Second Clinical College of Jilin University, Changchun, 130041, China. Tel.: 86-431-88796301; Fax: 86-431-88796301 Email: yutaojlucom; Gui-zhen Zhang M.D. and Ph.D., Department of Orthopedics of Second Clinical College of Jilin University, Changchun, 130041, China. Tel.: 86-431-88796301; Fax: 86-431-88796301 Email: zgzedu.cn


Published 2018-8-10